Review



ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain
    Ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg Target Hrv F Atcc Vr 1663d Commercial Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atcc+vr+1663d/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pm32161799-168-117-119
    Average 99 stars, based on 6 article reviews
    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains
    Article Snippet: GenBank: FJ445138.1 , High p H for Probe-HRV-[2, 5] , GGT C CC AT CCCG T AATTGCTC G TTACGAC TA GC C AC A CACTGGATTGT AT GCACT A GCT A CGGG T TTAAG G. .. Target-HRV-F , ATCC: VR-1663D , Commercial strain , na. .. Target-HRV-G , ZeptoMetrix: NATRVP-IDI , Commercial strain , na.

    Sequencing:

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains
    Article Snippet: GenBank: FJ445138.1 , High p H for Probe-HRV-[2, 5] , GGT C CC AT CCCG T AATTGCTC G TTACGAC TA GC C AC A CACTGGATTGT AT GCACT A GCT A CGGG T TTAAG G. .. Target-HRV-F , ATCC: VR-1663D , Commercial strain , na. .. Target-HRV-G , ZeptoMetrix: NATRVP-IDI , Commercial strain , na.

    Binding Assay:

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains
    Article Snippet: GenBank: FJ445138.1 , High p H for Probe-HRV-[2, 5] , GGT C CC AT CCCG T AATTGCTC G TTACGAC TA GC C AC A CACTGGATTGT AT GCACT A GCT A CGGG T TTAAG G. .. Target-HRV-F , ATCC: VR-1663D , Commercial strain , na. .. Target-HRV-G , ZeptoMetrix: NATRVP-IDI , Commercial strain , na.



    Similar Products

    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain  (ATCC)
    99
    ATCC ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain
    Ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg Target Hrv F Atcc Vr 1663d Commercial Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atcc+vr+1663d/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pm32161799-168-117-119
    Average 99 stars, based on 1 article reviews
    ggtcccatcccgtaattgctcgttacgactagccacacactggattgtatgcactagctacgggtttaagg target hrv f atcc vr 1663d commercial strain - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    atcc vr 1663d  (ATCC)
    99
    ATCC atcc vr 1663d
    HEV and HRV target sequences
    Atcc Vr 1663d, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/atcc+vr+1663d/Genomic+RNA+from+Human+rhinovirus+17+strain+33342/pmc06994036-25-2-2
    Average 99 stars, based on 1 article reviews
    atcc vr 1663d - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    HEV and HRV target sequences

    Journal: Biology Methods & Protocols

    Article Title: An array-based melt curve analysis method for the identification and classification of closely related pathogen strains

    doi: 10.1093/biomethods/bpy005

    Figure Lengend Snippet: HEV and HRV target sequences

    Article Snippet: Target-HRV-F , ATCC: VR-1663D , Commercial strain , na.

    Techniques: Amplification, Sequencing, Binding Assay